Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3615 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3615 Accession Number: MIMAT0017994 Mature Sequence: UCUCUCGGCUCCUCGCGGCUC hsa-miR-3615 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3615 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3615 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Hist1h2an sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3047705 3x 1.0 µg

Hist1h2an sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details
Human PAH (Phenylalanine Hydroxylase) QuickTest ELISA Kit
QT-EH3498 96 Tests

Human PAH (Phenylalanine Hydroxylase) QuickTest ELISA Kit

Sign In for Pricing
View Details
THOC7 (THO Complex Subunit 7 Homolog)
493853 100 µL

THOC7 (THO Complex Subunit 7 Homolog)

Sign In for Pricing
View Details
Plastin L Recombinant Antibody, AbBy Fluor™ 750 Conjugated
bsm-62866R-BF750-01 20 µL

Plastin L Recombinant Antibody, AbBy Fluor™ 750 Conjugated

Sign In for Pricing
View Details
Plastin L Recombinant Antibody, AbBy Fluor™ 750 Conjugated
bsm-62866R-BF750-02 100 µL

Plastin L Recombinant Antibody, AbBy Fluor™ 750 Conjugated

Sign In for Pricing
View Details
Recombinant Leptothrix cholodnii tRNA-specific 2-thiouridylase mnmA (mnmA)
MBS1127855-01 0.02 mg (E-Coli)

Recombinant Leptothrix cholodnii tRNA-specific 2-thiouridylase mnmA (mnmA)

Sign In for Pricing
View Details