Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8074 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8074 Accession Number: MIMAT0031001 Mature Sequence: CUAUGGCGAGACUGGCAUGUACUC hsa-miR-8074 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8074 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8074 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal MTHFD1 Antibody [mFluor Violet 450 SE]
NBP2-99164MFV450 0.1 mL

Rabbit Polyclonal MTHFD1 Antibody [mFluor Violet 450 SE]

Sign In for Pricing
View Details
Mouse Monoclonal TSH beta Antibody (TSH-116) [Janelia Fluor 549]
NB500-363JF549 0.1 mL

Mouse Monoclonal TSH beta Antibody (TSH-116) [Janelia Fluor 549]

Sign In for Pricing
View Details
RAPGEF5, CT (RAPGEF5, GFR, KIAA0277, MRGEF, Rap guanine nucleotide exchange factor 5, Guanine nucleotide exchange factor for Rap1, M-Ras-regulated Rap GEF, Related to Epac) (PE) discontinued
040834-PE 200 µL

RAPGEF5, CT (RAPGEF5, GFR, KIAA0277, MRGEF, Rap guanine nucleotide exchange factor 5, Guanine nucleotide exchange factor for Rap1, M-Ras-regulated Rap GEF, Related to Epac) (PE) discontinued

Sign In for Pricing
View Details
MrkA (Biotin)
569048-01 50 µg

MrkA (Biotin)

Sign In for Pricing
View Details
MrkA (Biotin)
569048-02 100 µg

MrkA (Biotin)

Sign In for Pricing
View Details
Ethyl 4- (Butylamino) Benzoate
RG-A261785-01 10 mg

Ethyl 4- (Butylamino) Benzoate

Sign In for Pricing
View Details