Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1204 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1204 Accession Number: MIMAT0005868 Mature Sequence: UCGUGGCCUGGUCUCCAUUAU hsa-miR-1204 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1204 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1204 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Fbxo34 Mouse shRNA Lentiviral Particle (Locus ID 78938)
TL517249V 500 µL Each

Fbxo34 Mouse shRNA Lentiviral Particle (Locus ID 78938)

Sign In for Pricing
View Details
Human Thymus Activation Regulated Chemokine (TARC) ELISA Kit
EKL62638 96 Tests

Human Thymus Activation Regulated Chemokine (TARC) ELISA Kit

Sign In for Pricing
View Details
PE/Cyanine7 anti-mouse CD11c
GT02450 100 µg

PE/Cyanine7 anti-mouse CD11c

Sign In for Pricing
View Details
Recombinant Clostridium Perfringens glpK Protein (aa 1-500) (strain ATCC 13124 / NCTC 8237 / Type A)
VAng-Lsx01044-500gEcoli 500 µg (E. coli)

Recombinant Clostridium Perfringens glpK Protein (aa 1-500) (strain ATCC 13124 / NCTC 8237 / Type A)

Sign In for Pricing
View Details
Recombinant Campylobacter Jejuni JJD26997_1899 Protein (aa 1-255)
VAng-Lsx6276-500gEcoli 500 µg (E. coli)

Recombinant Campylobacter Jejuni JJD26997_1899 Protein (aa 1-255)

Sign In for Pricing
View Details
Rabbit CD42 (Cluster of Differentiation 42) ELISA Kit
MBS2504383-01 24 Tests

Rabbit CD42 (Cluster of Differentiation 42) ELISA Kit

Sign In for Pricing
View Details