Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-635 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-635 Accession Number: MIMAT0003305 Mature Sequence: ACUUGGGCACUGAAACAAUGUCC hsa-miR-635 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-635 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-635 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

SREBP2 (SREBF2) Human qPCR Primer Pair (NM_004599)
HP207891 200 Reactions

SREBP2 (SREBF2) Human qPCR Primer Pair (NM_004599)

Sign In for Pricing
View Details
Amplifying Wash Buffer 20X
21760004-1 500 mL

Amplifying Wash Buffer 20X

Sign In for Pricing
View Details
HLA DQA1 Antibody, mAb, Rabbit
A03805-50 50 µL

HLA DQA1 Antibody, mAb, Rabbit

Sign In for Pricing
View Details
Mmu-miR-465d-5p miRNA Inhibitor
CIM1829-01 10 nmol

Mmu-miR-465d-5p miRNA Inhibitor

Sign In for Pricing
View Details
Mmu-miR-465d-5p miRNA Inhibitor
CIM1829-02 20 nmol

Mmu-miR-465d-5p miRNA Inhibitor

Sign In for Pricing
View Details
UBASH3A 3'UTR Luciferase Stable Cell Line
TU027630 1.0 mL

UBASH3A 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details