Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3614-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3614-5p Accession Number: MIMAT0017992 Mature Sequence: CCACUUGGAUCUGAAGGCUGCCC hsa-miR-3614-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3614-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3614-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

FAM199X siRNA (m)
sc-141567 10 µM

FAM199X siRNA (m)

Sign In for Pricing
View Details
XL388 5mg
A12395-5 5 mg

XL388 5mg

Sign In for Pricing
View Details
βENaC (D-3) Alexa Fluor® 647
sc-25354 AF647 200 µg/mL

βENaC (D-3) Alexa Fluor® 647

Sign In for Pricing
View Details
Human FHIT AssayLite™ Antibody (RPE Conjugate)
32967-05151 5x 30 µg

Human FHIT AssayLite™ Antibody (RPE Conjugate)

Sign In for Pricing
View Details
SNORD18C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2225507 1.0 µg DNA

SNORD18C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
MOCS2 antibody
70R-18563 50 ul

MOCS2 antibody

Sign In for Pricing
View Details