Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4683 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4683 Accession Number: MIMAT0019768 Mature Sequence: UGGAGAUCCAGUGCUCGCCCGAU hsa-miR-4683 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4683 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4683 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Vmn2r120 3'UTR Luciferase Stable Cell Line
TU122008 1.0 mL

Vmn2r120 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
DIS3L Polyclonal Antibody, RBITC Conjugated
bs-9052R-RBITC 100 µL

DIS3L Polyclonal Antibody, RBITC Conjugated

Sign In for Pricing
View Details
HPN (TMPRSS1, Serine Protease Hepsin, Transmembrane Protease Serine 1, Serine Protease Hepsin Non-catalytic Chain, Serine Protease Hepsin Catalytic Chain) (AP) discontinued
128060-AP 100 µL

HPN (TMPRSS1, Serine Protease Hepsin, Transmembrane Protease Serine 1, Serine Protease Hepsin Non-catalytic Chain, Serine Protease Hepsin Catalytic Chain) (AP) discontinued

Sign In for Pricing
View Details
CD90 Antibody (RPE)
GWB-562A19 100 Tests

CD90 Antibody (RPE)

Sign In for Pricing
View Details
Gamborg B-5 Basal Medium (Powder)
299646-01 5x 30 g

Gamborg B-5 Basal Medium (Powder)

Sign In for Pricing
View Details
Gamborg B-5 Basal Medium (Powder)
299646-02 10 x 30 g

Gamborg B-5 Basal Medium (Powder)

Sign In for Pricing
View Details