Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3920 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3920 Accession Number: MIMAT0018195 Mature Sequence: ACUGAUUAUCUUAACUCUCUGA hsa-miR-3920 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3920 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3920 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

KIF1C Knockout Raji Polyclonal Cells
ARG23911 1 Million

KIF1C Knockout Raji Polyclonal Cells

Sign In for Pricing
View Details
COL22A1 Protein Vector (Mouse) (pPM-C-HA)
PV167068 500 ng

COL22A1 Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
TUSC1 (Tumor Suppressor Candidate gene 1 Protein, TSG-9, TSG9, TUSC1) (Biotin) discontinued
302822-Biotin 100 µL

TUSC1 (Tumor Suppressor Candidate gene 1 Protein, TSG-9, TSG9, TUSC1) (Biotin) discontinued

Sign In for Pricing
View Details
CXC-Chemokine Receptor 3 (CXCR3) Sheep ELISA Kit
C6737 96 Tests

CXC-Chemokine Receptor 3 (CXCR3) Sheep ELISA Kit

Sign In for Pricing
View Details
Anti-p47 phox (Phospho-S328) Antibody
CPA4110-01 30 µL

Anti-p47 phox (Phospho-S328) Antibody

Sign In for Pricing
View Details
Anti-p47 phox (Phospho-S328) Antibody
CPA4110-02 50 μL

Anti-p47 phox (Phospho-S328) Antibody

Sign In for Pricing
View Details