Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-633 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-633 Accession Number: MIMAT0003303 Mature Sequence: CUAAUAGUAUCUACCACAAUAAA hsa-miR-633 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-633 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-633 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

HNRNPA0 (NM_006805) Human Recombinant Protein
TP303666M 100 µg

HNRNPA0 (NM_006805) Human Recombinant Protein

Sign In for Pricing
View Details
N-Nitrosoatrazine
TRC-N524800-1G 1 g

N-Nitrosoatrazine

Sign In for Pricing
View Details
HypoGel® 400 FP
SP400110150170.25G 25 g

HypoGel® 400 FP

Sign In for Pricing
View Details
RBM22 (Center) Rabbit Polyclonal Antibody
AP53606PU-N 400 µL

RBM22 (Center) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
ZCWPW2 (NM_001040432) Human Over-expression Lysate
LY421752 100 µg

ZCWPW2 (NM_001040432) Human Over-expression Lysate

Sign In for Pricing
View Details
Monoclonal Antibody to TLR6 (Clone: ABM1B50) -FITC Conjugated
10-3002-F-25 25 µg

Monoclonal Antibody to TLR6 (Clone: ABM1B50) -FITC Conjugated

Sign In for Pricing
View Details