Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4457 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4457 Accession Number: MIMAT0018979 Mature Sequence: UCACAAGGUAUUGACUGGCGUA hsa-miR-4457 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4457 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4457 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Aquaporin 1 (AQP1, CHIP, CHIP28) (Not for Export EU)
A3000-03B 100 µL

Aquaporin 1 (AQP1, CHIP, CHIP28) (Not for Export EU)

Sign In for Pricing
View Details
CHAC1 (NM_024111) Human Over-expression Lysate
LH00750V 100 µg

CHAC1 (NM_024111) Human Over-expression Lysate

Sign In for Pricing
View Details
KIAA0319 (Dyslexia-associated Protein KIAA0319, DLX2, DYLX2, MGC176717) (HRP)
MBS6400937-01 0.1 mL

KIAA0319 (Dyslexia-associated Protein KIAA0319, DLX2, DYLX2, MGC176717) (HRP)

Sign In for Pricing
View Details
KIAA0319 (Dyslexia-associated Protein KIAA0319, DLX2, DYLX2, MGC176717) (HRP)
MBS6400937-02 5x 0.1 mL

KIAA0319 (Dyslexia-associated Protein KIAA0319, DLX2, DYLX2, MGC176717) (HRP)

Sign In for Pricing
View Details
Formamide 99.5% AR
01247 00500 500 mL

Formamide 99.5% AR

Sign In for Pricing
View Details
ERCC1 (DNA Excision Repair Protein ERCC-1)
315127 100 µL

ERCC1 (DNA Excision Repair Protein ERCC-1)

Sign In for Pricing
View Details