Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4737 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4737 Accession Number: MIMAT0019863 Mature Sequence: AUGCGAGGAUGCUGACAGUG hsa-miR-4737 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4737 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4737 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

GENLISA Human Otopetrin 3 (OTOP3) ELISA
KBH14194 1x 96 Well

GENLISA Human Otopetrin 3 (OTOP3) ELISA

Sign In for Pricing
View Details
5HT7 Receptor Blocking Peptide
MBS9622026-01 1 mg

5HT7 Receptor Blocking Peptide

Sign In for Pricing
View Details
5HT7 Receptor Blocking Peptide
MBS9622026-02 5x 1 mg

5HT7 Receptor Blocking Peptide

Sign In for Pricing
View Details
Loncastuximab Biosimilar - Research Grade
ICH5655-10mg 10 mg

Loncastuximab Biosimilar - Research Grade

Sign In for Pricing
View Details
Cytochrome c Oxidase subunit 8C mitochondrial (COX8C) Mouse ELISA Kit
C7644 96 Tests

Cytochrome c Oxidase subunit 8C mitochondrial (COX8C) Mouse ELISA Kit

Sign In for Pricing
View Details
APC-Linked Monoclonal Antibody to Interleukin 10 (IL10)
MBS2165831-01 0.1 mL

APC-Linked Monoclonal Antibody to Interleukin 10 (IL10)

Sign In for Pricing
View Details