Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4737 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4737 Accession Number: MIMAT0019863 Mature Sequence: AUGCGAGGAUGCUGACAGUG hsa-miR-4737 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4737 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4737 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Olfr1309 sgRNA CRISPR Lentivector set (Mouse)
K4230601 3x 1.0 µg

Olfr1309 sgRNA CRISPR Lentivector set (Mouse)

Sign In for Pricing
View Details
Dnajb1 (NM_018808) Mouse Tagged ORF Clone Lentiviral Particle
MR205083L4V 200 µL

Dnajb1 (NM_018808) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
NDUFA5 (NADH Dehydrogenase [Ubiquinone] 1 alpha Subcomplex Subunit 5, Complex I Subunit B13, Complex I-13kD-B, CI-13kD-B, NADH-ubiquinone Oxidoreductase 13kD-B Subunit, DKFZp781K1356, FLJ12147) (HRP)
130213-HRP 100 µL

NDUFA5 (NADH Dehydrogenase [Ubiquinone] 1 alpha Subcomplex Subunit 5, Complex I Subunit B13, Complex I-13kD-B, CI-13kD-B, NADH-ubiquinone Oxidoreductase 13kD-B Subunit, DKFZp781K1356, FLJ12147) (HRP)

Sign In for Pricing
View Details
RFPL2 Rabbit pAb
E45R27515N-100 100 µL

RFPL2 Rabbit pAb

Sign In for Pricing
View Details
Lentiviral human ADGRF3 shRNA (UAS) - Lentiviral human ADGRF3 shRNA (UAS, iRFP) plasmid
GTR15081448 1 Vial

Lentiviral human ADGRF3 shRNA (UAS) - Lentiviral human ADGRF3 shRNA (UAS, iRFP) plasmid

Sign In for Pricing
View Details
Histone H1.3 Rabbit Monoclonal antibody
AMRe02084-01 1 Each

Histone H1.3 Rabbit Monoclonal antibody

Sign In for Pricing
View Details