Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4679 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4679 Accession Number: MIMAT0019763 Mature Sequence: UCUGUGAUAGAGAUUCUUUGCU hsa-miR-4679 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4679 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4679 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Wnt3a Rat shRNA Plasmid (Locus ID 303181)
TL705577 1 Kit

Wnt3a Rat shRNA Plasmid (Locus ID 303181)

Sign In for Pricing
View Details
Exoc6b (NM_177077) Mouse Tagged ORF Clone Lentiviral Particle
MR214323L4V 200 µL

Exoc6b (NM_177077) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
GABA A Receptor beta 3 (GABRB3) (NM_021912) Human Over-expression Lysate
LY411882 100 µg

GABA A Receptor beta 3 (GABRB3) (NM_021912) Human Over-expression Lysate

Sign In for Pricing
View Details
Mouse Pbdc1 (NM_026312) AAV Particle
MR201973A1V 250 µL

Mouse Pbdc1 (NM_026312) AAV Particle

Sign In for Pricing
View Details
Interleukin-3 Beta (IL-3b) Recombinant Rat
GWB-5A582A 0.02 mg

Interleukin-3 Beta (IL-3b) Recombinant Rat

Sign In for Pricing
View Details
BID Antibody
MBS850664-01 0.1 mg

BID Antibody

Sign In for Pricing
View Details