Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-544b miRNA Agomir/Antagomir

MicroRNA: hsa-miR-544b Accession Number: MIMAT0015004 Mature Sequence: ACCUGAGGUUGUGCAUUUCUAA hsa-miR-544b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-544b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-544b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

(R) -2-AMINOBUTYRIC ACID ETHYL ESTER HYDROCHLORIDE
JH914724 1 Each

(R) -2-AMINOBUTYRIC ACID ETHYL ESTER HYDROCHLORIDE

Sign In for Pricing
View Details
Recombinant Influenza B virus B/Brisbane/60/2008 Hemagglutinin Antigen (UV, formaldehyde inactivated)
VAC-0111 0.5 mL

Recombinant Influenza B virus B/Brisbane/60/2008 Hemagglutinin Antigen (UV, formaldehyde inactivated)

Sign In for Pricing
View Details
YY1 Antibody
F47256-0.4ML 0.4 mL

YY1 Antibody

Sign In for Pricing
View Details
Ctf1 Mouse siRNA Oligo Duplex (Locus ID 13019)
SR405228 1 Kit

Ctf1 Mouse siRNA Oligo Duplex (Locus ID 13019)

Sign In for Pricing
View Details
Anti-Actin pan Antibody
MBS8309928-01 0.03 mL

Anti-Actin pan Antibody

Sign In for Pricing
View Details
Anti-Actin pan Antibody
MBS8309928-02 0.05 mL

Anti-Actin pan Antibody

Sign In for Pricing
View Details