Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8066 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8066 Accession Number: MIMAT0030993 Mature Sequence: CAAUGUGAUCUUUUGGAUGUA hsa-miR-8066 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8066 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8066 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Polyclonal ADAM17 Antibody - C-terminal region
APG01553G 0.05mg

Polyclonal ADAM17 Antibody - C-terminal region

Sign In for Pricing
View Details
ELOVL6 Polyclonal Antibody
BT-AP02931-01 20 µL

ELOVL6 Polyclonal Antibody

Sign In for Pricing
View Details
ELOVL6 Polyclonal Antibody
BT-AP02931-02 50 µL

ELOVL6 Polyclonal Antibody

Sign In for Pricing
View Details
ELOVL6 Polyclonal Antibody
BT-AP02931-03 100 µL

ELOVL6 Polyclonal Antibody

Sign In for Pricing
View Details
C13orf1 (SPRYD7) (NM_001127482) Human Tagged ORF Clone
RG225140 10 µg

C13orf1 (SPRYD7) (NM_001127482) Human Tagged ORF Clone

Sign In for Pricing
View Details
[D-Pro10]-Dynorphin A (1-11), porcine
M41070-01 100 mg

[D-Pro10]-Dynorphin A (1-11), porcine

Sign In for Pricing
View Details