Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-761 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-761 Accession Number: MIMAT0010364 Mature Sequence: GCAGCAGGGUGAAACUGACACA hsa-miR-761 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-761 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-761 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

MGAM2 (NM_001293626) Human Tagged ORF Clone
RC240252 10 µg

MGAM2 (NM_001293626) Human Tagged ORF Clone

Sign In for Pricing
View Details
OR6N2 (NM_001005278) Human Over-expression Lysate
LY423837 100 µg

OR6N2 (NM_001005278) Human Over-expression Lysate

Sign In for Pricing
View Details
3110062M04Rik (NM_199145) Mouse Tagged Lenti ORF Clone
MR223713L4 10 µg

3110062M04Rik (NM_199145) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
C8a Mouse siRNA Oligo Duplex (Locus ID 230558)
SR417814 1 Kit

C8a Mouse siRNA Oligo Duplex (Locus ID 230558)

Sign In for Pricing
View Details
Rat Tumor Necrosis Factor Related Apoptosis Inducing Ligand 1 (TRAIL-1) ELISA Kit
NSL0074r 96 Tests

Rat Tumor Necrosis Factor Related Apoptosis Inducing Ligand 1 (TRAIL-1) ELISA Kit

Sign In for Pricing
View Details
Mouse Monoclonal ACCN2 Antibody (S271-44) [Alexa Fluor 700]
NBP2-22409AF700 0.1 mL

Mouse Monoclonal ACCN2 Antibody (S271-44) [Alexa Fluor 700]

Sign In for Pricing
View Details