Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-761 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-761 Accession Number: MIMAT0010364 Mature Sequence: GCAGCAGGGUGAAACUGACACA hsa-miR-761 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-761 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-761 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Myomegalin (m) -PR
sc-75850-PR 10 µM - 20 µL

Myomegalin (m) -PR

Sign In for Pricing
View Details
PRPH Polyclonal Antibody
UB-GEN-3101 100 µL

PRPH Polyclonal Antibody

Sign In for Pricing
View Details
Recombinant Rhesus Macaque MXD1 Protein, His (Fc)-Avi-tagged
MXD1-2732R 50 µg

Recombinant Rhesus Macaque MXD1 Protein, His (Fc)-Avi-tagged

Sign In for Pricing
View Details
Sulfotransferase 1A1 (SULT1A1) Antibody (Biotin)
abx275213-01 200 µL

Sulfotransferase 1A1 (SULT1A1) Antibody (Biotin)

Sign In for Pricing
View Details
Sulfotransferase 1A1 (SULT1A1) Antibody (Biotin)
abx275213-02 1 mL

Sulfotransferase 1A1 (SULT1A1) Antibody (Biotin)

Sign In for Pricing
View Details
FLII Human Pre-designed siRNA Set A
HY-RS04978 1 Set

FLII Human Pre-designed siRNA Set A

Sign In for Pricing
View Details