Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3915 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3915 Accession Number: MIMAT0018189 Mature Sequence: UUGAGGAAAAGAUGGUCUUAUU hsa-miR-3915 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3915 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3915 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Polk sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6972907 1.0 µg DNA

Polk sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

Sign In for Pricing
View Details
Mov10 3'UTR Luciferase Stable Cell Line
TU213325 1.0 mL

Mov10 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
Akap17b Mouse siRNA Oligo Duplex (Locus ID 338351)
SR421435 1 Kit

Akap17b Mouse siRNA Oligo Duplex (Locus ID 338351)

Sign In for Pricing
View Details
EHMT1, ID (Histone H3-K9 Methyltransferase 5, H3-K9-HMTase 5, Euchromatic Histone-lysine N-methyltransferase 1, Eu-HMTase1, G9a-like Protein 1, GLP1, Lysine N-methyltransferase 1D, EHMT1, EUHMTASE1, KIAA1876, KMT1D, Histone-lysine N-methyltransferase, H3 Lysine-9 Specific 5) (AP) discontinued
E8947-50H-AP 200 µL

EHMT1, ID (Histone H3-K9 Methyltransferase 5, H3-K9-HMTase 5, Euchromatic Histone-lysine N-methyltransferase 1, Eu-HMTase1, G9a-like Protein 1, GLP1, Lysine N-methyltransferase 1D, EHMT1, EUHMTASE1, KIAA1876, KMT1D, Histone-lysine N-methyltransferase, H3 Lysine-9 Specific 5) (AP) discontinued

Sign In for Pricing
View Details
Human Aquaporin 5,AQP-5 ELISA Kit
CN-04413H1 96T

Human Aquaporin 5,AQP-5 ELISA Kit

Sign In for Pricing
View Details
Rabbit anti-human Ubiquitin carboxyl-terminal hydrolase isozyme L1 polyclonal Antibody, Biotin conjugated
MBS715915-01 0.05 mg

Rabbit anti-human Ubiquitin carboxyl-terminal hydrolase isozyme L1 polyclonal Antibody, Biotin conjugated

Sign In for Pricing
View Details