Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3607-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3607-5p Accession Number: MIMAT0017984 Mature Sequence: GCAUGUGAUGAAGCAAAUCAGU hsa-miR-3607-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3607-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3607-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rat AGR2 ELISA Kit
ERA0464 96 Tests

Rat AGR2 ELISA Kit

Sign In for Pricing
View Details
10X Wash Buffer
DS0230-100ML 1 unit

10X Wash Buffer

Sign In for Pricing
View Details
SLC25A30 Human shRNA Plasmid Kit (Locus ID 253512)
TL309359 1 Kit

SLC25A30 Human shRNA Plasmid Kit (Locus ID 253512)

Sign In for Pricing
View Details
Human PTK2 shRNA Plasmid
abx953889-01 150 µg

Human PTK2 shRNA Plasmid

Sign In for Pricing
View Details
Human PTK2 shRNA Plasmid
abx953889-02 300 µg

Human PTK2 shRNA Plasmid

Sign In for Pricing
View Details
Superoxide Dismutase 1 Antibody / SOD1
V8619-20UG 20 µg

Superoxide Dismutase 1 Antibody / SOD1

Sign In for Pricing
View Details