Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4528 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4528 Accession Number: MIMAT0019067 Mature Sequence: UCAUUAUAUGUAUGAUCUGGAC hsa-miR-4528 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4528 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4528 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

LentimiRa-hsa-miR-4723-5p Vector
mh41983 500 ng

LentimiRa-hsa-miR-4723-5p Vector

Sign In for Pricing
View Details
Rev 6207 (free base)
HY-113748 1 Each

Rev 6207 (free base)

Sign In for Pricing
View Details
Mouse Monoclonal KIF2C Antibody (KIF2C/4707)
NBP3-20554-100ug 100 µg

Mouse Monoclonal KIF2C Antibody (KIF2C/4707)

Sign In for Pricing
View Details
Rabbit Polyclonal PARD6A Antibody
NBP3-38027-100ul 100 µL

Rabbit Polyclonal PARD6A Antibody

Sign In for Pricing
View Details
Hp16-INK4A, NT (S7) (CDKN2A, CDKN2, MTS1, Cyclin-dependent kinase inhibitor 2A, isoforms 1/2/3, Cyclin-dependent kinase 4 inhibitor A, Multiple tumor suppressor 1, p16-INK4a)
036742 200 µL

Hp16-INK4A, NT (S7) (CDKN2A, CDKN2, MTS1, Cyclin-dependent kinase inhibitor 2A, isoforms 1/2/3, Cyclin-dependent kinase 4 inhibitor A, Multiple tumor suppressor 1, p16-INK4a)

Sign In for Pricing
View Details
HDLBP Recombinant Rabbit mAb
E53M02324 100 µL

HDLBP Recombinant Rabbit mAb

Sign In for Pricing
View Details