Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4527 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4527 Accession Number: MIMAT0019066 Mature Sequence: UGGUCUGCAAAGAGAUGACUGU hsa-miR-4527 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4527 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4527 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Homez sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4239908 1.0 µg DNA

Homez sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details
PPIF mouse monoclonal antibody
E43B4515 100 µL

PPIF mouse monoclonal antibody

Sign In for Pricing
View Details
GABA Receptor A, alpha 6 (Gamma-aminobutyric Acid Receptor Type A alpha 6 Subunit, GABRA6) discontinued
G1015-08A 100 µg

GABA Receptor A, alpha 6 (Gamma-aminobutyric Acid Receptor Type A alpha 6 Subunit, GABRA6) discontinued

Sign In for Pricing
View Details
Mouse Mettl26 activation kit by CRISPRa
GA207786 1 Kit

Mouse Mettl26 activation kit by CRISPRa

Sign In for Pricing
View Details
Rabbit Polyclonal Mycobacterium Tuberculosis CFP10 Antibody [HRP]
NB110-58737H 0.1 mL

Rabbit Polyclonal Mycobacterium Tuberculosis CFP10 Antibody [HRP]

Sign In for Pricing
View Details
Human Protein-Glutamine Gamma-Glutamyltransferase K (Tgm1) Elisa Kit
EKC35272 96 Tests

Human Protein-Glutamine Gamma-Glutamyltransferase K (Tgm1) Elisa Kit

Sign In for Pricing
View Details