Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-555 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-555 Accession Number: MIMAT0003219 Mature Sequence: AGGGUAAGCUGAACCUCUGAU hsa-miR-555 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-555 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-555 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Stat6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6741908 1.0 µg DNA

Stat6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

Sign In for Pricing
View Details
Chicken high density lipoprotein cholesterol (HDL-C) ELISA Kit
EIA05783Ch 1 Kit

Chicken high density lipoprotein cholesterol (HDL-C) ELISA Kit

Sign In for Pricing
View Details
GPNMB CytoSection
TS407615P5 25 Slides

GPNMB CytoSection

Sign In for Pricing
View Details
Monoclonal SP7 Antibody (monoclonal) (M01), Clone: 2G6
AMM04123G 0.1mg

Monoclonal SP7 Antibody (monoclonal) (M01), Clone: 2G6

Sign In for Pricing
View Details
Rabbit Polyclonal SPCS2 Antibody [Alexa Fluor 750]
NBP3-18429AF750 0.1 mL

Rabbit Polyclonal SPCS2 Antibody [Alexa Fluor 750]

Sign In for Pricing
View Details
Rat Pth2r ELISA Kit
ELI-15494r 96 Tests

Rat Pth2r ELISA Kit

Sign In for Pricing
View Details