Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-320a miRNA Agomir/Antagomir

MicroRNA: hsa-miR-320a Accession Number: MIMAT0000510 Mature Sequence: AAAAGCUGGGUUGAGAGGGCGA hsa-miR-320a are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-320a in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-320a miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

UBQLN2 Antibody - N-terminal region
ARP59353_P050-25UL 25 µL

UBQLN2 Antibody - N-terminal region

Sign In for Pricing
View Details
NCKX2 (SLC24A2) (NM_001193288) Human Tagged ORF Clone Lentiviral Particle
RC230862L4V 200 µL

NCKX2 (SLC24A2) (NM_001193288) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Complement C3 (C3) (NM_000064) Human Tagged ORF Clone
RG215069 10 µg

Complement C3 (C3) (NM_000064) Human Tagged ORF Clone

Sign In for Pricing
View Details
MAGEA3 Mouse Monoclonal Antibody [Clone ID: LBI1G9]
AMM14826VCF 100 µg

MAGEA3 Mouse Monoclonal Antibody [Clone ID: LBI1G9]

Sign In for Pricing
View Details
ERCC8 (Center) Rabbit Polyclonal Antibody
AP51450PU-N 400 µL

ERCC8 (Center) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Rpl10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4408404 1.0 µg DNA

Rpl10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details