Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8058 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8058 Accession Number: MIMAT0030985 Mature Sequence: CUGGACUUUGAUCUUGCCAUAA hsa-miR-8058 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8058 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8058 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Fish Transcription Factor 7-Like 1 (TCF7L1) ELISA Kit
MBS9391888 Inquire

Fish Transcription Factor 7-Like 1 (TCF7L1) ELISA Kit

Sign In for Pricing
View Details
TMEM42 Protein Vector (Human) (pPB-N-His)
PV042890 500 ng

TMEM42 Protein Vector (Human) (pPB-N-His)

Sign In for Pricing
View Details
Pcdh9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4407206 1.0 µg DNA

Pcdh9 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details
B3GNT4 (NM_030765) Human Tagged ORF Clone Lentiviral Particle
RC206795L4V 200 µL

B3GNT4 (NM_030765) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
OsCOPT5 Rabbit pAb
A19149 50 µL

OsCOPT5 Rabbit pAb

Sign In for Pricing
View Details
PRPF4 AAV Vector (Human) (CMV)
37762101 1 µg

PRPF4 AAV Vector (Human) (CMV)

Sign In for Pricing
View Details