Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-554 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-554 Accession Number: MIMAT0003217 Mature Sequence: GCUAGUCCUGACUCAGCCAGU hsa-miR-554 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-554 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-554 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

GRHPR Antibody (N-term)
MBS9215666-01 0.05 mL

GRHPR Antibody (N-term)

Sign In for Pricing
View Details
GRHPR Antibody (N-term)
MBS9215666-02 5x 0.05 mL

GRHPR Antibody (N-term)

Sign In for Pricing
View Details
TFB1M (Dimethyladenosine Transferase 1, Mitochondrial, Mitochondrial 12S rRNA Dimethylase 1, Mitochondrial Transcription Factor B1, h-mtTFB, h-mtTFB1, hTFB1M, mtTFB1, S-adenosylmethionine-6-N', N'-adenosyl (rRNA) Dimethyltransferase 1, CGI75, CGI-75) (MaxLight 550)
134358-ML550 100 µL

TFB1M (Dimethyladenosine Transferase 1, Mitochondrial, Mitochondrial 12S rRNA Dimethylase 1, Mitochondrial Transcription Factor B1, h-mtTFB, h-mtTFB1, hTFB1M, mtTFB1, S-adenosylmethionine-6-N', N'-adenosyl (rRNA) Dimethyltransferase 1, CGI75, CGI-75) (MaxLight 550)

Sign In for Pricing
View Details
PDGFA, NT (Platelet-derived Growth Factor Subunit A, PDGF Subunit A, Platelet-derived Growth Factor A Chain, Platelet-derived Growth Factor alpha Polypeptide, PDGF-1, PDGF1) (Biotin) discontinued
P4258-16F-Biotin 200 µL

PDGFA, NT (Platelet-derived Growth Factor Subunit A, PDGF Subunit A, Platelet-derived Growth Factor A Chain, Platelet-derived Growth Factor alpha Polypeptide, PDGF-1, PDGF1) (Biotin) discontinued

Sign In for Pricing
View Details
Anti-Bevacizumab ELISA Kit
KAD12601 96 Tests

Anti-Bevacizumab ELISA Kit

Sign In for Pricing
View Details
Mouse SLC30A5 shRNA Plasmid
abx976831-01 150 µg

Mouse SLC30A5 shRNA Plasmid

Sign In for Pricing
View Details