Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6081 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6081 Accession Number: MIMAT0023706 Mature Sequence: AGGAGCAGUGCCGGCCAAGGCGCC hsa-miR-6081 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6081 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6081 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

VZV IgG ELISA Kit
MBS580129 Inquire

VZV IgG ELISA Kit

Sign In for Pricing
View Details
Goat Short Transient Receptor Potential Channel 1 (TRPC1) ELISA Kit
MBS9394566 Inquire

Goat Short Transient Receptor Potential Channel 1 (TRPC1) ELISA Kit

Sign In for Pricing
View Details
CD47 Mouse Monoclonal Antibody [Clone ID: LBI1C11]
AMM21121V 100 µL

CD47 Mouse Monoclonal Antibody [Clone ID: LBI1C11]

Sign In for Pricing
View Details
UBE1L / UBE2 Recombinant Antibody, AbBy Fluor™ 594 Conjugated
bsm-62787R-BF594 100 µL

UBE1L / UBE2 Recombinant Antibody, AbBy Fluor™ 594 Conjugated

Sign In for Pricing
View Details
Mouse Dalrd3 (NM_026378) AAV Particle
MR220507A1V 250 µL

Mouse Dalrd3 (NM_026378) AAV Particle

Sign In for Pricing
View Details
FLJ20643 (PIH1 Domain Containing 1, FLJ20643, NOP17) (FITC)
246184-FITC 100 µL

FLJ20643 (PIH1 Domain Containing 1, FLJ20643, NOP17) (FITC)

Sign In for Pricing
View Details