Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-623 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-623 Accession Number: MIMAT0003292 Mature Sequence: AUCCCUUGCAGGGGCUGUUGGGU hsa-miR-623 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-623 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-623 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD276/B7-H3 polyclonal antibody
BS77160-01 50 µL

CD276/B7-H3 polyclonal antibody

Sign In for Pricing
View Details
CD276/B7-H3 polyclonal antibody
BS77160-02 100 µL

CD276/B7-H3 polyclonal antibody

Sign In for Pricing
View Details
Recombinant Yersinia Enterocolitica mtnK Protein (aa 1-399) (strain 8081)
VAng-Wyb1649-50gEcoli 50 µg (E. coli)

Recombinant Yersinia Enterocolitica mtnK Protein (aa 1-399) (strain 8081)

Sign In for Pricing
View Details
C9orf116 (NM_144654) Human 3' UTR Clone
SC204558 10 µg

C9orf116 (NM_144654) Human 3' UTR Clone

Sign In for Pricing
View Details
Trophinin (Tro) Mouse Gene Knockout Kit (CRISPR)
KN518275 1 Kit

Trophinin (Tro) Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
LOC100039614 Protein Vector (Mouse) (pPM-C-HA)
PV197072 500 ng

LOC100039614 Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details