Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8054 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8054 Accession Number: MIMAT0030981 Mature Sequence: GAAAGUACAGAUCGGAUGGGU hsa-miR-8054 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8054 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8054 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Glucose Regulated Protein 94 (GRP94) (9G10.F8.2), CF640R conjugate, 0.1mg/mL
BNC400940-500 1x 500 µL

Glucose Regulated Protein 94 (GRP94) (9G10.F8.2), CF640R conjugate, 0.1mg/mL

Sign In for Pricing
View Details
PMP22 (NM_153322) Human Over-expression Lysate
LY403508 100 µg

PMP22 (NM_153322) Human Over-expression Lysate

Sign In for Pricing
View Details
Human RPUSD1 activation kit by CRISPRa
GA114383 1 Kit

Human RPUSD1 activation kit by CRISPRa

Sign In for Pricing
View Details
RGL2 (NM_004761) Human Recombinant Protein
TP307582 20 µg

RGL2 (NM_004761) Human Recombinant Protein

Sign In for Pricing
View Details
4930567H17Rik Mouse Gene Knockout Kit (CRISPR)
KN500403 1 Kit

4930567H17Rik Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
Myelin oligodendrocyte glycoprotein (MOG) Rabbit Monoclonal Antibody [Clone ID: R09-6I4]
TA384793 100 µL

Myelin oligodendrocyte glycoprotein (MOG) Rabbit Monoclonal Antibody [Clone ID: R09-6I4]

Sign In for Pricing
View Details