Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4521 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4521 Accession Number: MIMAT0019058 Mature Sequence: GCUAAGGAAGUCCUGUGCUCAG hsa-miR-4521 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4521 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4521 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Monkeypox virus (strain Zaire-96-I-16) A33R Protein, His Tag
A3R-M52H5-50ug 50 µg

Monkeypox virus (strain Zaire-96-I-16) A33R Protein, His Tag

Sign In for Pricing
View Details
NOX2/gp91phox
E8ET1611-44 100 µL

NOX2/gp91phox

Sign In for Pricing
View Details
CREB rabbit polyclonal antibody
E12-203- 100ug/100ul

CREB rabbit polyclonal antibody

Sign In for Pricing
View Details
Recombinant Monosiga brevicollis SURF1-like protein (18583), partial
MBS7066226 Inquire

Recombinant Monosiga brevicollis SURF1-like protein (18583), partial

Sign In for Pricing
View Details
Nnt (NM_008710) Mouse Tagged Lenti ORF Clone
MR211610L4 10 µg

Nnt (NM_008710) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Anti-ARG1 Polyclonal Antibody
HY339014-01 50 µg

Anti-ARG1 Polyclonal Antibody

Sign In for Pricing
View Details