Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-193a-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-193a-5p Accession Number: MIMAT0004614 Mature Sequence: UGGGUCUUUGCGGGCGAGAUGA hsa-miR-193a-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-193a-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-193a-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

10X PBS w/0.5% TWEEN 20 - 1L
IB70167-4 1 L

10X PBS w/0.5% TWEEN 20 - 1L

Ask
View Details
Human COL7A1 (Collagen alpha-1 (VII) chain) ELISA Kit
EKF57361 96 Tests

Human COL7A1 (Collagen alpha-1 (VII) chain) ELISA Kit

Ask
View Details
Leupeptin (Ac-Leu-Leu-L-methioninal)
L2050-01 1 mg

Leupeptin (Ac-Leu-Leu-L-methioninal)

Ask
View Details
Hexanedioic acid - 1,3-butanediol (1:1)
JH225561 1 Each

Hexanedioic acid - 1,3-butanediol (1:1)

Ask
View Details
CTBP1 (NM_001012614) Human Tagged ORF Clone Lentiviral Particle
RC208594L3V 200 µL

CTBP1 (NM_001012614) Human Tagged ORF Clone Lentiviral Particle

Ask
View Details