Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5196-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5196-5p Accession Number: MIMAT0021128 Mature Sequence: AGGGAAGGGGACGAGGGUUGGG hsa-miR-5196-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5196-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5196-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Olfr632 (NM_147119) Mouse Untagged Clone
MC214231 10 µg

Olfr632 (NM_147119) Mouse Untagged Clone

Sign In for Pricing
View Details
ICG ADIBO
DOC1061_25 mg 25 mg

ICG ADIBO

Sign In for Pricing
View Details
PPLK/GFP+Puro-TRAF4 shRNA-2
PPL00713-3a 1 Each

PPLK/GFP+Puro-TRAF4 shRNA-2

Sign In for Pricing
View Details
A-1155463 10mM * 1mL in DMSO
A16112-10mM-D 10 mM x 1mL in DMSO

A-1155463 10mM * 1mL in DMSO

Sign In for Pricing
View Details
Recombinant Escherichia coli O8 Outer membrane protein assembly factor yaeT (yaeT)
MBS1049722-01 0.02 mg (E-Coli)

Recombinant Escherichia coli O8 Outer membrane protein assembly factor yaeT (yaeT)

Sign In for Pricing
View Details
Recombinant Escherichia coli O8 Outer membrane protein assembly factor yaeT (yaeT)
MBS1049722-02 0.02 mg (Yeast)

Recombinant Escherichia coli O8 Outer membrane protein assembly factor yaeT (yaeT)

Sign In for Pricing
View Details