Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-618 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-618 Accession Number: MIMAT0003287 Mature Sequence: AAACUCUACUUGUCCUUCUGAGU hsa-miR-618 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-618 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-618 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Table Top Spectrophotometer
LX300TS 1 Unit

Table Top Spectrophotometer

Sign In for Pricing
View Details
Lentiviral mouse Spout1 shRNA (UAS) - Lentiviral mouse Spout1 shRNA (UAS) plasmid
GTR15185359 1 Vial

Lentiviral mouse Spout1 shRNA (UAS) - Lentiviral mouse Spout1 shRNA (UAS) plasmid

Sign In for Pricing
View Details
COX IV Rabbit mAb
E45R12943N-100 100 µL

COX IV Rabbit mAb

Sign In for Pricing
View Details
SLC16A11 discontinued
394442-01 20 µL

SLC16A11 discontinued

Sign In for Pricing
View Details
SLC16A11 discontinued
394442-02 200 µL

SLC16A11 discontinued

Sign In for Pricing
View Details
Anti-TMEM239 Antibody
MBS8323759-01 0.03 mL

Anti-TMEM239 Antibody

Sign In for Pricing
View Details