Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-618 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-618 Accession Number: MIMAT0003287 Mature Sequence: AAACUCUACUUGUCCUUCUGAGU hsa-miR-618 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-618 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-618 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Monoclonal Mesothelin Antibody (SPM143) [DyLight 755]
NBP3-11529IR 0.1 mL

Mouse Monoclonal Mesothelin Antibody (SPM143) [DyLight 755]

Sign In for Pricing
View Details
EphA7 (E-7) Alexa Fluor® 680
sc-393973 AF680 200 µg/mL

EphA7 (E-7) Alexa Fluor® 680

Sign In for Pricing
View Details
Cpxm2 3'UTR GFP Stable Cell Line
TU252759 1.0 mL

Cpxm2 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Hormad1 (NM_001289532) Mouse Tagged ORF Clone
MR229668 10 µg

Hormad1 (NM_001289532) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Dynamin 1 (DNM1) Rabbit Polyclonal Antibody
TA325410 100 µL

Dynamin 1 (DNM1) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Slc25a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
44000114 3x 1.0 µg

Slc25a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details