Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6074 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6074 Accession Number: MIMAT0023699 Mature Sequence: GAUAUUCAGAGGCUAGGUGG hsa-miR-6074 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6074 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6074 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Myosin, Smooth Muscle Heavy Chain (MYH11/923), Biotin conjugate, 0.1mg/mL
BNCB0923-500 1x 500 µL

Myosin, Smooth Muscle Heavy Chain (MYH11/923), Biotin conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Ecat1 (KHDC3L) (NM_001017361) Human Over-expression Lysate
LY400398 100 µg

Ecat1 (KHDC3L) (NM_001017361) Human Over-expression Lysate

Sign In for Pricing
View Details
NUFIP2 Rabbit Polyclonal Antibody
TA379404 100 µL

NUFIP2 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Factor I (CFI) Mouse Monoclonal Antibody [Clone ID: OTI4G8]
CF805918 100 µg

Factor I (CFI) Mouse Monoclonal Antibody [Clone ID: OTI4G8]

Sign In for Pricing
View Details
Cytochrome p450 2C19 (CYP2C19) (NM_000769) Human Recombinant Protein
TP311377M 100 µg

Cytochrome p450 2C19 (CYP2C19) (NM_000769) Human Recombinant Protein

Sign In for Pricing
View Details
C16orf91 (NM_001010878) Human Over-expression Lysate
LC423203 20 µg

C16orf91 (NM_001010878) Human Over-expression Lysate

Sign In for Pricing
View Details