Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-544a miRNA Agomir/Antagomir

MicroRNA: hsa-miR-544a Accession Number: MIMAT0003164 Mature Sequence: AUUCUGCAUUUUUAGCAAGUUC hsa-miR-544a are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-544a in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-544a miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Monoclonal IgA Antibody (rHISA43) [PE]
NBP3-08604PE 0.1 mL

Mouse Monoclonal IgA Antibody (rHISA43) [PE]

Sign In for Pricing
View Details
TNFRSF21 Polyclonal Antibody
AN006810L-01 25 µL

TNFRSF21 Polyclonal Antibody

Sign In for Pricing
View Details
TNFRSF21 Polyclonal Antibody
AN006810L-02 100 µL

TNFRSF21 Polyclonal Antibody

Sign In for Pricing
View Details
Matrix Metalloproteinase MT1 (MT1 MMP, Membrane Type 1, MMP-14) (MaxLight 650) discontinued
M2441-ML650 100 µL

Matrix Metalloproteinase MT1 (MT1 MMP, Membrane Type 1, MMP-14) (MaxLight 650) discontinued

Sign In for Pricing
View Details
Guinea Pig SPA ELISA Kit
EGS0166 96 Tests

Guinea Pig SPA ELISA Kit

Sign In for Pricing
View Details
DHRS4 Polyclonal Antibody, AbBy Fluor™ 680 Conjugated
bs-8264R-BF680 100 µL

DHRS4 Polyclonal Antibody, AbBy Fluor™ 680 Conjugated

Sign In for Pricing
View Details