Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-193b-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-193b-5p Accession Number: MIMAT0004767 Mature Sequence: CGGGGUUUUGAGGGCGAGAUGA hsa-miR-193b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-193b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-193b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human CTNNBIP1 Protein, N-His
YHJ67301 100 μg

Recombinant Human CTNNBIP1 Protein, N-His

Sign In for Pricing
View Details
MAP3K13 (LZK, Mitogen-activated Protein Kinase Kinase Kinase 13, Leucine Zipper-bearing Kinase, Mixed Lineage Kinase) (MaxLight 405) discontinued
129381-ML405 100 µL

MAP3K13 (LZK, Mitogen-activated Protein Kinase Kinase Kinase 13, Leucine Zipper-bearing Kinase, Mixed Lineage Kinase) (MaxLight 405) discontinued

Sign In for Pricing
View Details
WISP1 (Wnt1-inducible-signaling Pathway Protein 1, WISP-1, CCN Family Member 4, Wnt-1-induced Secreted Protein, CCN4) discontinued
W1450-51A 50 µg

WISP1 (Wnt1-inducible-signaling Pathway Protein 1, WISP-1, CCN Family Member 4, Wnt-1-induced Secreted Protein, CCN4) discontinued

Sign In for Pricing
View Details
1700049G17Rik sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4072102 1.0 µg DNA

1700049G17Rik sgRNA CRISPR Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details
ANKRD23 (NM_144994) Human Tagged ORF Clone Lentiviral Particle
RC223348L4V 200 µL

ANKRD23 (NM_144994) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Recombinant Saccharomyces cerevisiae Probable metalloreductase AIM14 (AIM14) , partial
MBS7061328 Inquire

Recombinant Saccharomyces cerevisiae Probable metalloreductase AIM14 (AIM14) , partial

Sign In for Pricing
View Details