Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4438 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4438 Accession Number: MIMAT0018956 Mature Sequence: CACAGGCUUAGAAAAGACAGU hsa-miR-4438 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4438 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4438 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Anti-SMUG1 Rabbit pAb
GB113395-100 100 μL

Anti-SMUG1 Rabbit pAb

Sign In for Pricing
View Details
St8sia6 (NM_213624) Rat Tagged ORF Clone Lentiviral Particle
RR209689L3V 200 µL

St8sia6 (NM_213624) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
RPL8P2 AAV siRNA Pooled Vector
41926161 1.0 µg

RPL8P2 AAV siRNA Pooled Vector

Sign In for Pricing
View Details
EIF2B4 Human qPCR Template Standard (NM_001034116)
HK208747 1 Kit

EIF2B4 Human qPCR Template Standard (NM_001034116)

Sign In for Pricing
View Details
Yeast Peptone Dextrose Agar Plate
LB2510 9 cm x 10 PCS/Pack

Yeast Peptone Dextrose Agar Plate

Sign In for Pricing
View Details
PSMB8 (NM_004159) Human Tagged Lenti ORF Clone
RC200353L3 10 µg

PSMB8 (NM_004159) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details