Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5192 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5192 Accession Number: MIMAT0021123 Mature Sequence: AGGAGAGUGGAUUCCAGGUGGU hsa-miR-5192 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5192 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5192 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human recombinant BMP-2 protein
PROTP12643-6-10ug 10 µg

Human recombinant BMP-2 protein

Sign In for Pricing
View Details
Human SMOX Recombinant Protein
PPT-15363 100 µg

Human SMOX Recombinant Protein

Sign In for Pricing
View Details
SH2D4A, NT (SH2D4A, SH2A, SH2 domain-containing protein 4A, Protein SH(2)A) (MaxLight 750)
MBS6347162-01 0.1 mL

SH2D4A, NT (SH2D4A, SH2A, SH2 domain-containing protein 4A, Protein SH(2)A) (MaxLight 750)

Sign In for Pricing
View Details
SH2D4A, NT (SH2D4A, SH2A, SH2 domain-containing protein 4A, Protein SH(2)A) (MaxLight 750)
MBS6347162-02 5x 0.1 mL

SH2D4A, NT (SH2D4A, SH2A, SH2 domain-containing protein 4A, Protein SH(2)A) (MaxLight 750)

Sign In for Pricing
View Details
Lentiviral mouse Exoc3l4 shRNA (UAS) - Lentiviral mouse Exoc3l4 shRNA (UAS) (100)
GTR15237882 1 Vial

Lentiviral mouse Exoc3l4 shRNA (UAS) - Lentiviral mouse Exoc3l4 shRNA (UAS) (100)

Sign In for Pricing
View Details
Rtdr1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3109305 3x 1.0 µg

Rtdr1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details