Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5192 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5192 Accession Number: MIMAT0021123 Mature Sequence: AGGAGAGUGGAUUCCAGGUGGU hsa-miR-5192 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5192 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5192 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cttnbp2nl sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4656202 1.0 µg DNA

Cttnbp2nl sgRNA CRISPR Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details
Sdsl Rat siRNA Oligo Duplex (Locus ID 360816)
SR504548 1 Kit

Sdsl Rat siRNA Oligo Duplex (Locus ID 360816)

Sign In for Pricing
View Details
Slc35f1 (NM_178675) Mouse Tagged ORF Clone Lentiviral Particle
MR206418L4V 200 µL

Slc35f1 (NM_178675) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Rabbit anti-MAST2 Antibody, Affinity Purified
A302-189A-T 10 µg

Rabbit anti-MAST2 Antibody, Affinity Purified

Sign In for Pricing
View Details
Cell cycle control protein 50A (TMEM30A) Rat ELISA Kit
C2657 96 Tests

Cell cycle control protein 50A (TMEM30A) Rat ELISA Kit

Sign In for Pricing
View Details
SLC22A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2172407 1.0 µg DNA

SLC22A3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

Sign In for Pricing
View Details