Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-548ba miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548ba Accession Number: MIMAT0031175 Mature Sequence: AAAGGUAACUGUGAUUUUUGCU hsa-miR-548ba are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-548ba in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-548ba miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal ART5 Antibody
NBP2-48808-25ul 25 µL

Rabbit Polyclonal ART5 Antibody

Sign In for Pricing
View Details
Bovine Interleukin 1 Beta (IL-1β) ELISA Kit
EIA05874Bo 1 Kit

Bovine Interleukin 1 Beta (IL-1β) ELISA Kit

Sign In for Pricing
View Details
Human anti-hepatitis A virus IgG antibody, anti-HAV ELISA KIT
ED0037Hu-01 96 Well

Human anti-hepatitis A virus IgG antibody, anti-HAV ELISA KIT

Sign In for Pricing
View Details
Human anti-hepatitis A virus IgG antibody, anti-HAV ELISA KIT
ED0037Hu-02 5x 96 Tests

Human anti-hepatitis A virus IgG antibody, anti-HAV ELISA KIT

Sign In for Pricing
View Details
Human anti-hepatitis A virus IgG antibody, anti-HAV ELISA KIT
ED0037Hu-03 10x 96 Tests

Human anti-hepatitis A virus IgG antibody, anti-HAV ELISA KIT

Sign In for Pricing
View Details
C6orf15 (NM_014070) Human Over-expression Lysate
LS029113-20ug 20 µg

C6orf15 (NM_014070) Human Over-expression Lysate

Sign In for Pricing
View Details