Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-455-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-455-3p Accession Number: MIMAT0004784 Mature Sequence: GCAGUCCAUGGGCAUAUACAC hsa-miR-455-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-455-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-455-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

OTOP1 (Center) Rabbit Polyclonal Antibody
AP53128PU-N 400 µL

OTOP1 (Center) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
MART-1 / Melan-A (M2-7C10 + M2-9E3), CF568 conjugate, 0.1mg/mL
BNC680705-500 1x 500 µL

MART-1 / Melan-A (M2-7C10 + M2-9E3), CF568 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Tbc1d30 Mouse Gene Knockout Kit (CRISPR)
KN517253 1 Kit

Tbc1d30 Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
N,alpha-Diethylphenethylamine Hydrochloride
TRC-D444710-5MG 5 mg

N,alpha-Diethylphenethylamine Hydrochloride

Sign In for Pricing
View Details
DOK3 Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2B11]
TA813139BM 100 µL

DOK3 Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2B11]

Sign In for Pricing
View Details
CD31 / PECAM-1 (JC/70A), CF488A conjugate, 0.1mg/mL
BNC880639-100 1x 100 µL

CD31 / PECAM-1 (JC/70A), CF488A conjugate, 0.1mg/mL

Sign In for Pricing
View Details