Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3185 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3185 Accession Number: MIMAT0015065 Mature Sequence: AGAAGAAGGCGGUCGGUCUGCGG hsa-miR-3185 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3185 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3185 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD34 Monoclonal Antibody
bsm-41196M 100 µL

CD34 Monoclonal Antibody

Sign In for Pricing
View Details
V-ATPase D1 (D-4) : m-IgG Fc BP-HRP Bundle
sc-527680 1 Kit

V-ATPase D1 (D-4) : m-IgG Fc BP-HRP Bundle

Sign In for Pricing
View Details
Human NFAM1 activation kit by CRISPRa
GA115750 1 Kit

Human NFAM1 activation kit by CRISPRa

Sign In for Pricing
View Details
RGD1563667 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6490302 1.0 µg DNA

RGD1563667 sgRNA CRISPR Lentivector (Rat) (Target 1)

Sign In for Pricing
View Details
Sdhaf1 AAV siRNA Pooled Vector
43249164 1.0 µg

Sdhaf1 AAV siRNA Pooled Vector

Sign In for Pricing
View Details
Klk1b4 Protein Vector (Mouse) (pPB-N-His)
PV194839 500 ng

Klk1b4 Protein Vector (Mouse) (pPB-N-His)

Sign In for Pricing
View Details