Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3185 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3185 Accession Number: MIMAT0015065 Mature Sequence: AGAAGAAGGCGGUCGGUCUGCGG hsa-miR-3185 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3185 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3185 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

C1r sgRNA CRISPR Lentivector (Rat) (Target 1)
K6711602 1.0 µg DNA

C1r sgRNA CRISPR Lentivector (Rat) (Target 1)

Sign In for Pricing
View Details
FAM102A (NM_203305) Human Tagged Lenti ORF Clone
RC220739L3 10 µg

FAM102A (NM_203305) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
NTMT1 Antibody, Biotin conjugated
A69285-100UG 100 µg

NTMT1 Antibody, Biotin conjugated

Sign In for Pricing
View Details
Dimethylpropiothetin hydrochloride
MF-0125281-01 10 mg

Dimethylpropiothetin hydrochloride

Sign In for Pricing
View Details
Dimethylpropiothetin hydrochloride
MF-0125281-02 50 mg

Dimethylpropiothetin hydrochloride

Sign In for Pricing
View Details
CDK3, NT (Y19) (CDK3, CDKN3, Cyclin-dependent kinase 3, Cell division protein kinase 3) (MaxLight 490) discontinued
033661-ML490 100 µL

CDK3, NT (Y19) (CDK3, CDKN3, Cyclin-dependent kinase 3, Cell division protein kinase 3) (MaxLight 490) discontinued

Sign In for Pricing
View Details