Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-532-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-532-5p Accession Number: MIMAT0002888 Mature Sequence: CAUGCCUUGAGUGUAGGACCGU hsa-miR-532-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-532-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-532-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human Endoglin / CD105 Protein, His Tag
ENN-H52H9-500ug 500 µg

Human Endoglin / CD105 Protein, His Tag

Sign In for Pricing
View Details
Slc25a5 ORF Vector (Rat) (pORF)
ORF076426 1.0 µg DNA

Slc25a5 ORF Vector (Rat) (pORF)

Sign In for Pricing
View Details
beta-Catenin modulator-3
MBS5820763 Inquire

beta-Catenin modulator-3

Sign In for Pricing
View Details
MTF2 Recombinant Protein (Mouse)
RP152036 100 µg

MTF2 Recombinant Protein (Mouse)

Sign In for Pricing
View Details
SSA1 (Tripartite Motif-containing 21, 52kD Ribonucleoprotein Autoantigen Ro/SS-A, 52kD Ro Protein, RING Finger Protein 81, RNF81, Ro (SS-A), RO52, Sjoegren Syndrome Type A Antigen, SSA, SS-A, TRIM21, Tripartite Motif-containing Protein 21) (MaxLight 405) discontinued
133851-ML405 100 µL

SSA1 (Tripartite Motif-containing 21, 52kD Ribonucleoprotein Autoantigen Ro/SS-A, 52kD Ro Protein, RING Finger Protein 81, RNF81, Ro (SS-A), RO52, Sjoegren Syndrome Type A Antigen, SSA, SS-A, TRIM21, Tripartite Motif-containing Protein 21) (MaxLight 405) discontinued

Sign In for Pricing
View Details
Recombinant Coxiella burnetii DNA repair protein recO (recO)
MBS1238476-01 0.02 mg (E-Coli)

Recombinant Coxiella burnetii DNA repair protein recO (recO)

Sign In for Pricing
View Details