Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5188 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5188 Accession Number: MIMAT0021119 Mature Sequence: AAUCGGACCCAUUUAAACCGGAG hsa-miR-5188 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5188 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5188 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

MYH3 Antibody
DF9647-01 100 µL

MYH3 Antibody

Sign In for Pricing
View Details
MYH3 Antibody
DF9647-02 200 µL

MYH3 Antibody

Sign In for Pricing
View Details
Recombinant Murine MCP-3/CCL7
P6789-10μg 10 µg

Recombinant Murine MCP-3/CCL7

Sign In for Pricing
View Details
SSR3 ORF Vector (Human) (pORF)
45548011 1.0 µg DNA

SSR3 ORF Vector (Human) (pORF)

Sign In for Pricing
View Details
Human HSP-70/HSPA9 ELISA Kit
E108514 1 Each

Human HSP-70/HSPA9 ELISA Kit

Sign In for Pricing
View Details
Human PIP4P1 (NM_144568) AAV Particle
RC205440A1V 250 µL

Human PIP4P1 (NM_144568) AAV Particle

Sign In for Pricing
View Details