Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-613 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-613 Accession Number: MIMAT0003281 Mature Sequence: AGGAAUGUUCCUUCUUUGCC hsa-miR-613 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-613 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-613 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Shigella Sonnei lolB Protein (aa 22-207)
VAng-Lsx09832-500gEcoli 500 µg (E. coli)

Recombinant Shigella Sonnei lolB Protein (aa 22-207)

Sign In for Pricing
View Details
Csta1 Mouse qPCR Primer Pair (NM_001033239)
MP203150 200 Reactions

Csta1 Mouse qPCR Primer Pair (NM_001033239)

Sign In for Pricing
View Details
Anti-Nurr1 Antibody
bs-70937R 100 µL

Anti-Nurr1 Antibody

Sign In for Pricing
View Details
Angptl8 (NM_001080940) Mouse Tagged Lenti ORF Clone
MR217800L3 10 µg

Angptl8 (NM_001080940) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Rabbit Monoclonal IFN-alpha B2/IFN-alpha 8 Antibody (003) [Alexa Fluor 750]
NBP2-89440AF750 0.1 mL

Rabbit Monoclonal IFN-alpha B2/IFN-alpha 8 Antibody (003) [Alexa Fluor 750]

Sign In for Pricing
View Details
General Adenosine triphosphate, ATP ELISA KIT
ELI-06774Ge 96 Tests

General Adenosine triphosphate, ATP ELISA KIT

Sign In for Pricing
View Details