Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4775 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4775 Accession Number: MIMAT0019931 Mature Sequence: UUAAUUUUUUGUUUCGGUCACU hsa-miR-4775 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4775 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4775 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

GTP binding protein REM1 Antibody, AbBy Fluor™ 488 Conjugated
bs-7502R-BF488 100 µL

GTP binding protein REM1 Antibody, AbBy Fluor™ 488 Conjugated

Sign In for Pricing
View Details
UBASH3A (NM_018961) Human Over-expression Lysate
LS053347-100ug 100 µg

UBASH3A (NM_018961) Human Over-expression Lysate

Sign In for Pricing
View Details
Rabbit anti-Ashbya gossypii (strain 10895/CBS 109.51/FGSC 9923/NRRL Y-1056)(Yeast)(Eremothecium gossypii) TEF3 Polyclonal Antibody
MBS7199101 Inquire

Rabbit anti-Ashbya gossypii (strain 10895/CBS 109.51/FGSC 9923/NRRL Y-1056)(Yeast)(Eremothecium gossypii) TEF3 Polyclonal Antibody

Sign In for Pricing
View Details
Recombinant SARS-CoV-2 P.1.8 Spike RBD His-tag Protein CF
11036-CV-100 100 µg

Recombinant SARS-CoV-2 P.1.8 Spike RBD His-tag Protein CF

Sign In for Pricing
View Details
Anti-GM-CSF (plonmarlimab biosimilar) mAb
E33B100130 50 µg

Anti-GM-CSF (plonmarlimab biosimilar) mAb

Sign In for Pricing
View Details
Hsd17b2 3'UTR Luciferase Stable Cell Line
TU109766 1.0 mL

Hsd17b2 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details