Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4775 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4775 Accession Number: MIMAT0019931 Mature Sequence: UUAAUUUUUUGUUUCGGUCACU hsa-miR-4775 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4775 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4775 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human CD177/CD177 antigen ELISA Kit
E0407Hu 96 Tests

Human CD177/CD177 antigen ELISA Kit

Sign In for Pricing
View Details
NACAD Lentiviral Activation Particles (h)
sc-411676-LAC 200 µL

NACAD Lentiviral Activation Particles (h)

Sign In for Pricing
View Details
SLC22A12 (Solute Carrier Family 22 Member 12, Organic Anion Transporter 4-like Protein, Renal-specific Transporter, RST, Urate Anion Exchanger 1, OATL4, URAT1, UNQ6453/PRO34004) (FITC)
133422-FITC 100 µL

SLC22A12 (Solute Carrier Family 22 Member 12, Organic Anion Transporter 4-like Protein, Renal-specific Transporter, RST, Urate Anion Exchanger 1, OATL4, URAT1, UNQ6453/PRO34004) (FITC)

Sign In for Pricing
View Details
Ang4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3259103 1.0 µg DNA

Ang4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

Sign In for Pricing
View Details
(-) -Oxypeucedanin hydrate
MF-0002361-01 1 mg

(-) -Oxypeucedanin hydrate

Sign In for Pricing
View Details
(-) -Oxypeucedanin hydrate
MF-0002361-02 5 mg

(-) -Oxypeucedanin hydrate

Sign In for Pricing
View Details