Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4775 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4775 Accession Number: MIMAT0019931 Mature Sequence: UUAAUUUUUUGUUUCGGUCACU hsa-miR-4775 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4775 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4775 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Capza2 Mouse qPCR Template Standard (NM_007604)
MK202837 1 Kit

Capza2 Mouse qPCR Template Standard (NM_007604)

Sign In for Pricing
View Details
C14orf61 Human shRNA Lentiviral Particle (Locus ID 283580)
TL320033V 500 µL Each

C14orf61 Human shRNA Lentiviral Particle (Locus ID 283580)

Sign In for Pricing
View Details
NDOR1 (NM_001144026) Human Tagged ORF Clone Lentiviral Particle
RC226636L4V 200 µL

NDOR1 (NM_001144026) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Mouse Wdr35 Pre-designed siRNA Set A
SI116010A 1 Each

Mouse Wdr35 Pre-designed siRNA Set A

Sign In for Pricing
View Details
Ribonuclease Inhibitor (RNH1) (NM_002939) Human Over-expression Lysate
LH19341V 100 µg

Ribonuclease Inhibitor (RNH1) (NM_002939) Human Over-expression Lysate

Sign In for Pricing
View Details
Simian Macrophage Migration Inhibitory Factor, MIF ELISA Kit
QY-E110013 96 Tests

Simian Macrophage Migration Inhibitory Factor, MIF ELISA Kit

Sign In for Pricing
View Details