Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4507 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4507 Accession Number: MIMAT0019044 Mature Sequence: CUGGGUUGGGCUGGGCUGGG hsa-miR-4507 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4507 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4507 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

PTGER2 (Prostanoid EP2 Receptor, Prostaglandin E2 Receptor EP2 Subtype, PGE2 Receptor EP2 Subtype, PGE Receptor EP2 Subtype) (APC)
132018-APC 100 µL

PTGER2 (Prostanoid EP2 Receptor, Prostaglandin E2 Receptor EP2 Subtype, PGE2 Receptor EP2 Subtype, PGE Receptor EP2 Subtype) (APC)

Sign In for Pricing
View Details
OLIG1 (Oligodendrocyte Transcription Factor 1, Oligo1, Class B Basic Helix-loop-helix Protein 6, bHLHb6, Class E Basic Helix-loop-helix Protein 21, bHLHe21, BHLHB6, BHLHE21) (PE)
MBS6387985-01 0.1 mL

OLIG1 (Oligodendrocyte Transcription Factor 1, Oligo1, Class B Basic Helix-loop-helix Protein 6, bHLHb6, Class E Basic Helix-loop-helix Protein 21, bHLHe21, BHLHB6, BHLHE21) (PE)

Sign In for Pricing
View Details
OLIG1 (Oligodendrocyte Transcription Factor 1, Oligo1, Class B Basic Helix-loop-helix Protein 6, bHLHb6, Class E Basic Helix-loop-helix Protein 21, bHLHe21, BHLHB6, BHLHE21) (PE)
MBS6387985-02 5x 0.1 mL

OLIG1 (Oligodendrocyte Transcription Factor 1, Oligo1, Class B Basic Helix-loop-helix Protein 6, bHLHb6, Class E Basic Helix-loop-helix Protein 21, bHLHe21, BHLHB6, BHLHE21) (PE)

Sign In for Pricing
View Details
PLV2-CMV-DPP4 (human) -Myc-Puro
BZ49909 1 Vial

PLV2-CMV-DPP4 (human) -Myc-Puro

Sign In for Pricing
View Details
Sheep Zeatin Riboside (ZR) ELISA Kit
OM624758 96 Strip Well

Sheep Zeatin Riboside (ZR) ELISA Kit

Sign In for Pricing
View Details
Recombinant Vaccinia virus 39kDa core protein (A4L)
MBS1055141-01 0.02 mg (E-Coli)

Recombinant Vaccinia virus 39kDa core protein (A4L)

Sign In for Pricing
View Details