Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-204-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-204-5p Accession Number: MIMAT0000265 Mature Sequence: UUCCCUUUGUCAUCCUAUGCCU hsa-miR-204-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-204-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-204-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Alox15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7546404 1.0 µg DNA

Alox15 sgRNA CRISPR Lentivector (Rat) (Target 3)

Sign In for Pricing
View Details
Prpf18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
37754116 3x 1.0 µg

Prpf18 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

Sign In for Pricing
View Details
JWH-081 Pentanoic Acid
TRC-J211403-250MG 250 mg

JWH-081 Pentanoic Acid

Sign In for Pricing
View Details
SART1 Protein Vector (Rat) (pPB-C-His)
PV303318 500 ng

SART1 Protein Vector (Rat) (pPB-C-His)

Sign In for Pricing
View Details
Human Cathepsin B ELISA Kit
RK01210 96 Tests

Human Cathepsin B ELISA Kit

Sign In for Pricing
View Details
DSPE-PEG1000-CGKRK
MF-0122864-01 10 mg

DSPE-PEG1000-CGKRK

Sign In for Pricing
View Details