Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-943 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-943 Accession Number: MIMAT0004986 Mature Sequence: CUGACUGUUGCCGUCCUCCAG hsa-miR-943 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-943 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-943 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

MAD2L1 binding protein (MAD2L1BP) (NM_001003690) Human Tagged Lenti ORF Clone
RC223487L4 10 µg

MAD2L1 binding protein (MAD2L1BP) (NM_001003690) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
KLK2 Antibody
GWB-MN970G 50 µg

KLK2 Antibody

Sign In for Pricing
View Details
Mouse Monoclonal KCTD15 Antibody (AT4C3) [Biotin]
NBP1-49429B 0.1 mL

Mouse Monoclonal KCTD15 Antibody (AT4C3) [Biotin]

Sign In for Pricing
View Details
5β-CHOLANIC ACID-7α, 12α-DIOL-3-ONE DIACETATE METHYL ESTER
503362 Inquire

5β-CHOLANIC ACID-7α, 12α-DIOL-3-ONE DIACETATE METHYL ESTER

Sign In for Pricing
View Details
PLCXD2 (NM_001134478) Human Over-expression Lysate
LY427454 100 µg

PLCXD2 (NM_001134478) Human Over-expression Lysate

Sign In for Pricing
View Details
KRTCAP3 (NM_001168364) Human Tagged ORF Clone Lentiviral Particle
RC229746L3V 200 µL

KRTCAP3 (NM_001168364) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details