Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-943 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-943 Accession Number: MIMAT0004986 Mature Sequence: CUGACUGUUGCCGUCCUCCAG hsa-miR-943 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-943 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-943 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

OR2C3, CT (OR2C3, OR2C4, OR2C5P, Olfactory receptor 2C3, Olfactory receptor 2C4, Olfactory receptor 2C5, Olfactory receptor OR1-30) (MaxLight 750)
MBS6328380-01 0.1 mL

OR2C3, CT (OR2C3, OR2C4, OR2C5P, Olfactory receptor 2C3, Olfactory receptor 2C4, Olfactory receptor 2C5, Olfactory receptor OR1-30) (MaxLight 750)

Sign In for Pricing
View Details
OR2C3, CT (OR2C3, OR2C4, OR2C5P, Olfactory receptor 2C3, Olfactory receptor 2C4, Olfactory receptor 2C5, Olfactory receptor OR1-30) (MaxLight 750)
MBS6328380-02 5x 0.1 mL

OR2C3, CT (OR2C3, OR2C4, OR2C5P, Olfactory receptor 2C3, Olfactory receptor 2C4, Olfactory receptor 2C5, Olfactory receptor OR1-30) (MaxLight 750)

Sign In for Pricing
View Details
Mouse Monoclonal ErbB2/Her2 Antibody (HRB2/451) [mFluor Violet 450 SE]
NBP2-33064MFV450 0.1 mL

Mouse Monoclonal ErbB2/Her2 Antibody (HRB2/451) [mFluor Violet 450 SE]

Sign In for Pricing
View Details
Anti-Human CD269/TNFRSF17/BCMA Antibody (SAA0816), PE
FHF92422 100 Tests

Anti-Human CD269/TNFRSF17/BCMA Antibody (SAA0816), PE

Sign In for Pricing
View Details
Cep78 (NM_198019) Mouse Tagged ORF Clone Lentiviral Particle
MR210667L3V 200 µL

Cep78 (NM_198019) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
TMCO2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
46828111 3x 1.0 µg

TMCO2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details