Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-199b-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-199b-3p Accession Number: MIMAT0004563 Mature Sequence: ACAGUAGUCUGCACAUUGGUUA hsa-miR-199b-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-199b-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-199b-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

RNASEH1 Antibody, Biotin conjugated
A33287-50UG 50 µg

RNASEH1 Antibody, Biotin conjugated

Sign In for Pricing
View Details
C-C Chemokine Receptor Type 7 (CCR7) Antibody
abx421214-01 50 µg

C-C Chemokine Receptor Type 7 (CCR7) Antibody

Sign In for Pricing
View Details
C-C Chemokine Receptor Type 7 (CCR7) Antibody
abx421214-02 100 µg

C-C Chemokine Receptor Type 7 (CCR7) Antibody

Sign In for Pricing
View Details
KDM1/LSD1 Recombinant Antibody, Cy7 Conjugated
bsm-62859R-Cy7 100 µL

KDM1/LSD1 Recombinant Antibody, Cy7 Conjugated

Sign In for Pricing
View Details
DiagNano™ TiO2 Coated Silica Particles, 20 μm
DAG-WT1578 10 mL

DiagNano™ TiO2 Coated Silica Particles, 20 μm

Sign In for Pricing
View Details
EFCAB14 (KIAA0494, EF-hand Calcium-binding Domain-containing Protein 14) (AP) discontinued
137929-AP 100 µL

EFCAB14 (KIAA0494, EF-hand Calcium-binding Domain-containing Protein 14) (AP) discontinued

Sign In for Pricing
View Details