Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4717-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4717-3p Accession Number: MIMAT0019830 Mature Sequence: ACACAUGGGUGGCUGUGGCCU hsa-miR-4717-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4717-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4717-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

POLDIP3, NT (POLDIP3, KIAA1649, PDIP46, Polymerase delta-interacting protein 3, 46kD DNA polymerase delta interaction protein, S6K1 Aly/REF-like target)
MBS6002300-01 0.2 mL

POLDIP3, NT (POLDIP3, KIAA1649, PDIP46, Polymerase delta-interacting protein 3, 46kD DNA polymerase delta interaction protein, S6K1 Aly/REF-like target)

Sign In for Pricing
View Details
POLDIP3, NT (POLDIP3, KIAA1649, PDIP46, Polymerase delta-interacting protein 3, 46kD DNA polymerase delta interaction protein, S6K1 Aly/REF-like target)
MBS6002300-02 5x 0.2 mL

POLDIP3, NT (POLDIP3, KIAA1649, PDIP46, Polymerase delta-interacting protein 3, 46kD DNA polymerase delta interaction protein, S6K1 Aly/REF-like target)

Sign In for Pricing
View Details
Olfr1290 Double Nickase Plasmid (m)
sc-434255-NIC 20 µg

Olfr1290 Double Nickase Plasmid (m)

Sign In for Pricing
View Details
2B1G rabbit pAb
RA21483-01 50 µL

2B1G rabbit pAb

Sign In for Pricing
View Details
2B1G rabbit pAb
RA21483-02 100 µL

2B1G rabbit pAb

Sign In for Pricing
View Details
Human KLHDC4 ELISA KIT
EF010555 96 Tests

Human KLHDC4 ELISA KIT

Sign In for Pricing
View Details