Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3180-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3180-3p Accession Number: MIMAT0015058 Mature Sequence: UGGGGCGGAGCUUCCGGAGGCC hsa-miR-3180-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3180-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3180-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human ATG2B activation kit by CRISPRa
GA110515 1 Kit

Human ATG2B activation kit by CRISPRa

Sign In for Pricing
View Details
SEL1L Antibody, HRP conjugated
A67376-100UG 100 µg

SEL1L Antibody, HRP conjugated

Sign In for Pricing
View Details
IL7 Over-expression Lysate Product
GWB-961FB6 0.1 mg

IL7 Over-expression Lysate Product

Sign In for Pricing
View Details
PSPH (Phosphoserine Phosphatase, L-3-phosphoserine Phosphatase, O-phosphoserine Phosphohydrolase, OTTHUMP00000025059, PSPase, PSP) (PE)
MBS6161445-01 0.1 mL

PSPH (Phosphoserine Phosphatase, L-3-phosphoserine Phosphatase, O-phosphoserine Phosphohydrolase, OTTHUMP00000025059, PSPase, PSP) (PE)

Sign In for Pricing
View Details
PSPH (Phosphoserine Phosphatase, L-3-phosphoserine Phosphatase, O-phosphoserine Phosphohydrolase, OTTHUMP00000025059, PSPase, PSP) (PE)
MBS6161445-02 5x 0.1 mL

PSPH (Phosphoserine Phosphatase, L-3-phosphoserine Phosphatase, O-phosphoserine Phosphohydrolase, OTTHUMP00000025059, PSPase, PSP) (PE)

Sign In for Pricing
View Details
Rabbit Polyclonal ZC3HAV1L Antibody
NBP2-58199-25ul 25 µL

Rabbit Polyclonal ZC3HAV1L Antibody

Sign In for Pricing
View Details