Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1266-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1266-5p Accession Number: MIMAT0005920 Mature Sequence: CCUCAGGGCUGUAGAACAGGGCU hsa-miR-1266-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1266-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1266-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

C10orf107 3'UTR Luciferase Stable Cell Line
TU002702 1.0 mL

C10orf107 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
PRR16, CT (PRR16, Proline-rich protein 16, Mesenchymal stem cell protein DSC54) (MaxLight 490) discontinued
040500-ML490 100 µL

PRR16, CT (PRR16, Proline-rich protein 16, Mesenchymal stem cell protein DSC54) (MaxLight 490) discontinued

Sign In for Pricing
View Details
Slc47a1 (BC031436) Mouse Tagged ORF Clone Lentiviral Particle
MR208532L3V 200 µL

Slc47a1 (BC031436) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
IGSF8 Knockout SK-HEP-1 Polyclonal Cells
ARG32654 1 Million

IGSF8 Knockout SK-HEP-1 Polyclonal Cells

Sign In for Pricing
View Details
Foxf2 Mouse Gene Knockout Kit (CRISPR)
KN306079RB 1 Kit

Foxf2 Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
SUV39H2 CRISPRa sgRNA lentivector (set of three targets)(Human)
45912121 3x 1.0µg DNA

SUV39H2 CRISPRa sgRNA lentivector (set of three targets)(Human)

Sign In for Pricing
View Details