Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1266-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1266-5p Accession Number: MIMAT0005920 Mature Sequence: CCUCAGGGCUGUAGAACAGGGCU hsa-miR-1266-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1266-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1266-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

NCX2 HDR Plasmid (h)
sc-403352-HDR 20 µg

NCX2 HDR Plasmid (h)

Sign In for Pricing
View Details
S100A7 sgRNA CRISPR Lentivector set (Human)
K2082801 3x 1.0 µg

S100A7 sgRNA CRISPR Lentivector set (Human)

Sign In for Pricing
View Details
Immunol Fluorescence Staining Kit with Alexa Fluor 555-Labeled Donkey Anti-Rabbit IgG
P0179 > 300 Tests

Immunol Fluorescence Staining Kit with Alexa Fluor 555-Labeled Donkey Anti-Rabbit IgG

Sign In for Pricing
View Details
Recombinant Rat TGM3 Protein, His (Fc)-Avi-tagged
TGM3-5699R 50 µg

Recombinant Rat TGM3 Protein, His (Fc)-Avi-tagged

Sign In for Pricing
View Details
Nipsnap3b (NM_001009422) Rat Tagged ORF Clone Lentiviral Particle
RR203226L4V 200 µL

Nipsnap3b (NM_001009422) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Human CCDC50 Protein Lysate
MBS138835-01 0.02 mg

Human CCDC50 Protein Lysate

Sign In for Pricing
View Details