Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-320b miRNA Agomir/Antagomir

MicroRNA: hsa-miR-320b Accession Number: MIMAT0005792 Mature Sequence: AAAAGCUGGGUUGAGAGGGCAA hsa-miR-320b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-320b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-320b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Human Monoclonal CD20 Antibody (Regeneron patent anti-CD20) [CoraFluor 1]
NBP3-28262CL1 0.1 mL

Human Monoclonal CD20 Antibody (Regeneron patent anti-CD20) [CoraFluor 1]

Ask
View Details
Rat Transcription Factor GATA-4, GATA-4 ELISA Kit
MBS1604107-01 48 Well

Rat Transcription Factor GATA-4, GATA-4 ELISA Kit

Ask
View Details
Rat Transcription Factor GATA-4, GATA-4 ELISA Kit
MBS1604107-02 96 Well

Rat Transcription Factor GATA-4, GATA-4 ELISA Kit

Ask
View Details
Rat Transcription Factor GATA-4, GATA-4 ELISA Kit
MBS1604107-03 5x 96 Well

Rat Transcription Factor GATA-4, GATA-4 ELISA Kit

Ask
View Details
Rat Transcription Factor GATA-4, GATA-4 ELISA Kit
MBS1604107-04 10x 96 Well

Rat Transcription Factor GATA-4, GATA-4 ELISA Kit

Ask
View Details
TFIIIB'' siRNA (m)
sc-155869 10 µM

TFIIIB'' siRNA (m)

Ask
View Details