Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5705 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5705 Accession Number: MIMAT0022499 Mature Sequence: UGUUUCGGGGCUCAUGGCCUGUG hsa-miR-5705 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5705 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5705 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Trpm1 ORF Vector (Mouse) (pORF)
48520015 1.0 µg DNA

Trpm1 ORF Vector (Mouse) (pORF)

Sign In for Pricing
View Details
VRK1 (NM_003384) Human Recombinant Protein
E45H32137E1 50 µg

VRK1 (NM_003384) Human Recombinant Protein

Sign In for Pricing
View Details
FAM101B (RFLNB) CytoSection
TS407704P5 25 Slides

FAM101B (RFLNB) CytoSection

Sign In for Pricing
View Details
Mouse Monoclonal Langerin/CD207 Antibody (LGRN/7541)
NBP3-20557-100ug 100 µg

Mouse Monoclonal Langerin/CD207 Antibody (LGRN/7541)

Sign In for Pricing
View Details
Fancb ORF Vector (Mouse) (pORF)
ORF044570 1.0 µg DNA

Fancb ORF Vector (Mouse) (pORF)

Sign In for Pricing
View Details
FOXO4 Recombinant Monoclonal Antibody [1A3]
A74212-050 50 µL

FOXO4 Recombinant Monoclonal Antibody [1A3]

Sign In for Pricing
View Details